acemos HOME

acemos CABLE

acemos CIENCIA

acemos EVENTO

acemos ADMISION

acemos CONVOCATORIA

acemos CONTACTO





http://static.ak.fbcdn.net/images/fbconnect/login-buttons/connect_light_medium_long.gif





16 marzo 2013

laboratorio NCBI

TTCTTTCTCCCCCGCTCCTCCGCCGTGTGCCACGGAGCACGTCAGAGTCAATCAAGGTCGAGAGTTATCTTTTAAAAAAACAGCAGGGAAGAAGAAGGAAATGACGTACGAGGGAGCCATCGGCATCGATCTCGGCACAACTTACTCGTGCGTTGGTGTTTGGCAGAACGAGCGCGTGGAGATCATTGCGAACGATCAGGGCAGCCGCACAACGCCGTCGTACGTGGCGTTCACCGACACGGAGCGTCTGATCGGTGATGCCGCGAAGAACCAGGTTGCGATGAACCCGACGAACACCGTCTTCGACGCGAAGCGCCTCATTGGGCGGAAGTTCAGCGACCCCGTTGTGCAGTCGGACATGAAGCACTGGCCCTTCAAGGTCATCACGAAGGGCGACGACAAGCCGGTGATCCAGGTGCAGTTCCGCGGCGAGACAAAGACGTTCAACCCGGAGGAGGTGAGCTCGATGGTGCTGTCAAAGATGAAGGAGATTGCGGAGTCGTACCTGGGCAAGCAGGTGAAGAAGGCCGTGGTGACTGTGCCCGCGTACTTCAACGACTCCCAGCGGCAGGCGACGAAGGATGCCGGCACGATCGCGGGGATGGAGGTGCTGCGCATCATCAATGAGCCGACAGCTGCCGCCATTGCGTATGGCCTGGACAAAGTGGAGGACGGCAAGGAGCGCAATGTGCTCATCTTTGACCTTGGCGGCGGCACGTTTGATGTCACGCTGCTGACGATCGACGGTGGCATCTTTGAGGTGAAGGCGACGAACGGCGACACGCACCTGGGCGGCGAGGACTTTGACAACCGCCTCGTGTCGCACTTCACGGACGAGTTCAAGCGCAAGAACAAGGGCAAGGACCTGACGACAAGCCAGCGCGCCCTCCGCCGCCTCCGCACCGCCTGCGAGCGCGCCAAGCGCACGCTGTCGTCCGCGGCACAGGCGACGATTGAGATCGACGCGCTGTTCGACAACGTGGACTTCCAGGCAACCATCACTCGCGCCCGCTTCGAGGAGCTCTGCGGCGACCTCTTCCGAGGGACGCTGCAGCCGGTGGAGCGTGTGCTCCAGGACGCCAAGATGGACAAGCGTGCCGTGCACGACGTGGTGCTCGTCGGCGGCTCCACCCGCATTCCAAAGGTGATGCAGCTGGTGTCGGACTTTTTCGGTGGCAAGGAACTGAACAAGAGCATCAACCCTGATGAGGCTGTGGCGTACGGTGCCGCCGTGCAGGCCTTCATCCTGACGGGCGGCAAGAGCAAGCAGACGGAGGGCCTGCTGCTGCTCGACGTGACCCCGCTGACGCTTGGCATCGAGACGGCGGGTGGCGTCATGACGTCGCTGATCAAGCGCAACACGACGATTCCGACCAAGAAAAGCCAGATCTTCTCGACGTACGCGGACAACCAGCCGGGCGTGCACATCCAGGTCTTTGAGGGAGAGCGTGCGATGACGAAGGACTGCCACCTGCTCGGCACATTCGACCTGTCCGGCATCCCGCCGGCGCCGCGCGGTGTGCCCCAGATTGAGGTGACCTTTGACCTCGACGCCAACGGCATCCTGAACGTGTCCGCGGAGGAGAAGGGCACCGGTAAGCGCAACCAGATTGTCATCACGAACGACAAGGGCCGCCTGAGCAAGGCGGACATTGAGCGCATGGTGTCCGAGGCTGCCAAGTACGAGGCGCAGGACAAGGAACAGCGCGAGCGCATTGACGCAAAGAACGGTCTTGAGAACTACGCATTTTCGATGAAGAACACCGTAAACGAGCCGAACGTCGCTGGCAAGATTGAGGAGGCCGACAAGAACACGATTACGAGTGCCGTGGAGGAGGCGCTGCAATGGCTGAACAACAACCAGGAGGCCAGCAAGGAGGAGTACGAGCACCGCCAGAAGGAGCTGGAGAACCTGTGCACGCCCATCATGACGAAGATGTACCAGGGCATGGGCGCGGGCGGCGGTATGCCTGGCGGTATGCCTGGCGGTATGCCCGGCGGTATGCCTGGCGGTATGCCTGGCGGTATGCCCGGCGGTATGCCTGGCGGTATGCCTGGTGGAATGCCCGGGGGCATGCCTGGCGGCGCGAACCCGTCGTCTTCGTCAGGACCGAAGGTGGAGGAAGTTGACTGAGAGCGCATCCCTGAAGATGTTCTCATGGCGGCGTCTGTTCGCGAACGAATAACCCGTTGGTTTTCTCCTTTGTAGAACGTAGTGGTCTGCGACAAACCCA  

2 comentarios:

David Montero dijo...

Trypanosoma cruzi strain CL Brener heat shock protein 70 (HSP70) partial mRNA

David Montero dijo...
Este comentario ha sido eliminado por el autor.